Promega's Cookie Policy

We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work. For others, we won’t set them unless you accept them. To find out more about cookies and how to manage cookies, read our Cookie Policy.

Q5401_pUC-3aM13-Primer--Reverse--17mer---2ug_3 new-kit-box

Designed for Sequencing Inserts Cloned into the M13 Vectors and pUC Plasmids

  • Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
  • Supplied at a concentration of 10μg/ml
  • pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
  • pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

Catalog Number:

Choose a primer length and direction

Size

Catalog Number: Q5401

Catalog Number: Q5601


Overview
Protocols
Specifications
Resources
Related Products

The pUC/M13 Primers are used to sequence inserts cloned into the M13 vectors and pUC plasmids developed by Messing. The primers are purified by gel electrophoresis or HPLC and supplied in sterile water.

Primer Sequences

  • Reverse (17mer): 5´-d(CAGGAAACAGCTATGAC)-3´
  • Forward (24mer): 5´-d(CGCCAGGGTTTTCCCAGTCACGAC)-3´

Reference

  1. Messing, J. (1983) Meth. Enzymol. 101, 20–78.

Protocols

No protocols available

Specifications

Catalog Number:

What's in the box?

Item Part # Size

pUC/M13 Primer, Reverse (17mer)

Q540A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

What's in the box?

Item Part # Size

pUC/M13 Primer, Forward (24mer)

Q560A 1 × 2μg

Certificate of Analysis

Search by lot number

Use Restrictions

For Research Use Only. Not for Use in Diagnostic Procedures.

Storage Conditions

BB

Resources

No related resources available