Promega's Cookie Policy

We use cookies and similar technologies to make our website work, run analytics, improve our website, and show you personalized content and advertising. Some of these cookies are essential for our website to work. For others, we won’t set them unless you accept them. To find out more about cookies and how to manage cookies, read our Cookie Policy.

Purification of Bacterial DNA from Food Samples using the Maxwell® RSC PureFood Pathogen Kit

Sarah Teter, Promega Corporation

Publication Date: 06/18

Abstract

Food samples were spiked with bacteria and enriched by culturing with the appropriate enrichment media. The Maxwell® RSC PureFood Pathogen Kit was used to detect low levels of bacterial contamination.

Methods

Strategy

We spiked a variety of food types with bacterial food contaminants, enriched samples via a standard processing protocol and extracted DNA using the Maxwell® RSC PureFood GMO and Authentication Kit with a new Lysis Buffer and Lysis Buffer A. The PureFood GMO and Authentication chemistry is the basis of the new PureFood Pathogen Kit with an altered upfront lysis to improve recovery of microorganisms that are common food contaminants. Food samples were spiked as indicated in Table 1.

Table 1. Samples were spiked with the indicated bacteria.

E. coli S. enterica L. monocytogenes
Strawberries Roast Beef Cold Cut Meat Soft Cheese
Cilantro Raw Frozen Shrimp Canned Chicken

Materials

• EZ-CFU Reference Culture – Listeria monocytogenes (ATCC 19115; Microbiologics, Cat.# 0687Z)
• EZ-CFU Reference Culture – Salmonella enterica (ATCC 13311; Microbiologics, Cat.# 0421C)
• EZ-CFU Reference Culture – Escherichia coli (ATCC 35150 (STEC); Microbiologics, Cat.# 06117E3)
• Canned chicken
• Soft Mexican cheese
• Raw shrimp
• Sliced roast beef deli meat
• Strawberries
• Cilantro
• Seward Stomacher® 400 Circulator
• Stomacher Blender Bags (Fisher Scientific, Cat.# 14258204)
• Ready-to-use Half Fraser Media (Bio-Rad, Cat.# 3555797)
• Buffered Peptone Water (Bio-Rad, Cat.# 3554179)
• 37°C Incubator
• LB Plates (LSS)
• Tryptic Soy Agar (TSA) Plates (LSS)
• Maxwell® PureFood GMO and Authentication Kit (Cat.# AS1600)
• Lysis Buffer (Cat.# A8261)
• Lysis Buffer A
• GoTaq® Probe qPCR Master Mix (Cat.# A6101)
• Listeria monocytogenes serotype 1/2b DNA (Zeptometrix, Cat.# 0801534DNA-10µg)
• Salmonella enterica Typhimurium Z005 DNA (Zeptometrix, Cat.# 0801437DNA-10µg)
• Escherichia coli O157:H7; EDL933 DNA (Zeptometrix, Cat.# 0801622DNA-10µg)
• QuantiFluor® ONE dsDNA System (Cat.# E4871)

Listeria Primers (IDT):
• ListeriahlyProbe — 5'-/56-FAM/CGCCTGCAA/ZEN/GTCCTAAGACGCCA/3IABkFQ/-3'
• listeriahlyF — 5'-CTCACCAGGAGATTACAACATGG-3'
• listeriahlyR — 5'-ATCCGCGTGTTTCTTTTCGA-3'

Salmonella Primers (IDT):
• SalmonellattrProbe — 5'-/56-FAM/CACCGACGG/ZEN/CGAGACCGACTTT/3IABkFQ/-3'
• SalmonellattrF — 5'-CTCACCAGGAGATTACAACATGG-3'
• SalmonellattrR — 5'-AGCTCAGACCAAAAGTGACCATC-3'

E. coli Primers (IDT):
• ecoliO157stx1Probe — 5'-/6-FAM/CTGGATGAT/ZEN/CTCAGTGGGCGTTCTTATGAA/3IABkFQ/-3'
• ecoliO157stx1F — 5'-TTTGTYACTGTSACAGCWGAAGCYTTACG-3'
• ecoliO157stx1R — 5'-CCCCAGTTCARWGTRAGRTCMACRTC-3'

Methods

Inoculation of Food Samples with E. coli:
1. Prepared the E. coli suspension.
• Each of the bacterial discs contained 9.4×10^3 CFU.
• Added 3.9ml of the hydrating dilution fluid to 1 pellet (concentration = ~2500 CFU/ml)
2. 25g of strawberries or cilantro was weighed into a Stomacher® bag containing 225ml of Peptone Buffered Water (PBW). [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the E. coli suspension, as shown in Table 2.
4. Additionally, 50 and 100µl of the suspension was plated on LB plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.

Table 2. Inoculation of samples with E. coli.

CFU/g Total CFU Volume E. coli Suspension Added (µl)
0 0 0
5 125 50
10 250 100
50 1250 500

Inoculation of Food Samples with S. enterica:
1. Prepared the S. enterica suspension.
• Each of the bacterial discs contained 6.8×10^3 CFU.
• Added 2.7ml of the hydrating dilution fluid to 1 pellet (concentration = ~2500 CFU/ml)
2. 25g of shrimp or deli meat was weighed into the Stomacher® bag containing 225ml of PBW. [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the S. enterica suspension, as shown in Table 3.
4. Additionally, 50 and 100µl of the suspension was plated on LB plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.

Table 3. Inoculation of samples with S. enterica.

CFU/g Total CFU Volume S. enterica Suspension Added (µl)
0 0 0
5 125 50
10 250 100
50 1250 500

Inoculation of Food Samples with L. monocytogenes:
1. Prepared the L. monocytogenes suspension.
• Each of the bacterial discs contained 5.3×10^2 CFU.
• Added 1.7ml of the hydrating dilution fluid to 4 pellets (concentration = ~1250 CFU/ml)
2. 25g of canned meat or soft cheese was weighed into the Stomacher® bags containing 225ml of half Fraser Broth [4 bags/sample type]
3. Bags were inoculated with ~0, 5, 10 or 50 CFU/g of the L. monocytogenes suspension, as shown in Table 4.
4. Additionally, 50µl of the suspension was plated on TSA plates to determine accurate CFU counts.
5. Samples were incubated at 37°C for approximately 20 hours.

Table 4. Inoculation of samples with L. monocytogenes.

CFU/g Total CFU Volume L. monocytogenes Suspension Added (µl)
0 0 0
5 125 100
10 250 200
20 500 500

DNA Purification from all Sample Types:
1. 800µl of the enriched sample was transferred to a 1.5ml tube.
2. 200µl of Lysis Buffer A was added and the sample was spun in a vortex at 56°C for 4 minutes.
3. 300µl of Lysis Buffer (Cat.# A8261). The sample was spun in a vortex for 10 seconds.
4. The entire volume of lysate was transferred to well #1 of the Maxwell® RSC PureFood GMO and Authentication Kit Cartridge.
5. The sample was processed in the Maxwell® RSC Instrument using the RSC Blood DNA method.
6. Most samples contained a white/tan precipitate. All samples were spun at maximum speed in a microcentrifuge for two minutes. Eluates were transferred to clean tubes, avoiding the transfer of any of the pelleted precipitate.

DNA Concentration by QuantiFluor® ONE dsDNA System:
DNA was quantified using the method prescribed in the technical manual, TM405. Total fluorescence was measured on the Quantus™ Instrument, which had been calibrated with the Lambda DNA standard provided in the kit.

qPCR with Species-Specific Primers:
1. A 20X primer and probe mix was prepared (18µM forward and reverse primers and 5µM probe).
2. The reaction mixture was prepared according to Table 5. For reactions amplified on the ABI 7500, CXR passive-reference dye was added to a final concentration of 30nM.
3. Standard curves were prepared using the appropriate reference standard. Seven 5X serial dilutions were prepared with each bacterial standard using nuclease-free water as the diluent. The highest concentration points were 5ng/µl, 25ng/µl and 25ng/µl for L. monocytogenes, E. coli, and S. enterica, respectively.
4. 2µl of the eluate or standard was added to 18µl of the reaction mixture. Analysis with the QuantiFluor® ONE dsDNA system indicated a need to dilute eluates for the S. enterica (shrimp and sliced roast beef) and E. coli (cilantro and strawberry) samples prior to amplification. Eluates were diluted 1:10 to bring them into an acceptable range for qPCR assay (<100ng total DNA added/reaction).
5. The reactions were amplified either on the ABI 7500 qPCR Instrument (S. enterica) or on the Bio-Rad CFX qPCR Instrument (E. coli and L. monocytogenes).

Table 5. Amplification Reaction Setup.

Component Volume/Reaction
GoTaq® Probe qPCR Master Mix, dTTP (2X) 10µl
20X Primer/Probe Mix (900nM F/R primers, 250nM Probe) 1µl
Nuclease-free Water 7µl
Sample 2µl
Total 20µl

Results

DNA was extracted from 800µl of enriched cultures containing food samples using the new Maxwell® RSC PureFood Pathogen chemistry. For each extraction, total DNA concentration was determined using the QuantiFluor® ONE dsDNA System, and the concentration of the spiked bacterium was determined using species-specific bacterial primers and probes. For E. coli 0157:H7, we were able to detect the E. coli 0157:H7 DNA in all spiked samples of cilantro and strawberries (Figures 1 and 2). The required sensitivity was <100 CFU/gram of sample and we were able to detect E. coli DNA at even the lowest bacterial count tested, which was 4.1 CFU/gram starting concentration prior to enrichment. For S. enterica, we were able to detect the S. enterica DNA in all spiked samples of shrimp and roast beef cold cut meat (Figures 3 and 4). The required sensitivity was <10 CFU/gram of sample and we were able to detect S. enterica at even the lowest bacterial count tested, which was 7.7 CFU/gram starting concentration prior to enrichment. Finally, for L. monocytogenes, we were able to detect the L. monocytogenes DNA in all spiked samples of soft cheese and canned chicken (Figures 5 and 6). The required sensitivity was <100 CFU/gram of sample, and we were able to detect L. monocytogenes DNA at even the lowest bacterial count tested, which was 1.7 CFU/gram starting concentration prior to enrichment.

A

Comparison of total DNA and E. coli 0157:H7 DNA extracted

B

Comparison of total DNA and E. coli 0157:H7 DNA extracted from cilantro

Figure 1. Comparison of total DNA and E. coli 0157:H7 DNA extracted from cilantro samples spiked with the indicated amount of E. coli 0157:H7 bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of E. coli 0157:H7 DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

A

Comparison of total DNA and E. coli 0157:H7 DNA extracted from strawberry

B

Comparison of total DNA and E. coli 0157:H7 DNA extracted from strawberry

Figure 2. Comparison of total DNA and E. coli 0157:H7 DNA extracted from strawberry samples spiked with the indicated amount of E. coli 0157:H7 bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of E. coli 0157:H7 DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

A

Comparison of total DNA and S. enterica DNA extracted from raw shrimp

B

Comparison of total DNA and S. enterica DNA extracted from raw shrimp
Figure 3. Comparison of total DNA and S. enterica DNA extracted from raw shrimp samples spiked with the indicated amounts of S. enterica bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of S. enterica DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

A

Comparison of total DNA and S. enterica DNA extracted from roast beef cold cut meat

B

Comparison of total DNA and S. enterica DNA extracted from roast beef cold cut meat
Figure 4. Comparison of total DNA and S. enterica DNA extracted from roast beef cold cut meat samples spiked with the indicated amounts of S. enterica bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in peptone buffered water (PBW) for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of S. enterica DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

A

Figure 5. Comparison of total DNA and L. monocytogenes DNA extracted from soft cheese

B

Figure 5. Comparison of total DNA and L. monocytogenes DNA extracted from soft cheese
Figure 5. Comparison of total DNA and L. monocytogenes DNA extracted from soft cheese samples spiked with the indicated amounts of L. monocytogenes bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in Half Fraser Broth for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of L. monocytogenes DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

A

Comparison of total DNA and L. monocytogenes DNA extracted from canned chicken

B

Comparison of total DNA and L. monocytogenes DNA extracted from canned chicken
Figure 6. Comparison of total DNA and L. monocytogenes DNA extracted from canned chicken samples spiked with the indicated amounts of L. monocytogenes bacteria. Samples were spiked with the indicated number of bacteria (colony forming units/gram). Samples were enriched by culturing in Half Fraser Broth for 20 hours at 37°C. DNA was extracted from 800µl of sample (four replicates/condition). The total DNA concentration in the eluates was assessed using the QuantiFluor® ONE dsDNA System (Panel A), and the concentration of L. monocytogenes DNA was assessed with specific primers (Panel B). Error bars represent the standard deviation for quadruplicate purifications.

Conclusions

We were able to detect low levels of bacterial contamination in food samples spiked with bacteria and enriched by culturing with the appropriate enrichment media. E. coli spiked into cilantro and strawberry samples was detected at a concentration as low as 4.1 CFU/gram in the pre-enriched food culture. S. enterica spiked into roast beef cold cut meat and raw shrimp samples was detected at a concentration as low as 7.7 CFU/gram in the pre-enriched food culture. L. monocytogenes spiked into soft cheese and canned chicken samples was detected at a concentration as low as 1.7 CFU/gram in the pre-enriched food culture.

Learn more about the Maxwell® RSC PureFood Pathogen Kit.

View Product Details