Promega's Política de cookies

Empleamos cookies y tecnologías similares para mantener la funcionalidad de nuestro sitio web, analizar su rendimiento, mejorar el funcionamiento y mostrar contenido personalizado. Algunas cookies son esenciales para el buen funcionamiento de nuestro sitio web. El resto no serán instaladas en su equipo sin su consentimiento. Visite la Política de Cookies para obtener mayor detalle.

CloneWeaver® Workflow Purchasing Tool

Previous Next

Cloning Enzymes

Name Applications Description Part Number
Alkaline Phosphatase, Calf Intestinal (CIAP) Open/Close Open/Close Add
Available at high concentration; Cat.# M2825 contains 1,000 units of CIAP at 20u/μl
Qualified for blue/white cloning; our assay provides a higher level of quality control for enzymes used in cloning applications

Alkaline Phosphatase, Calf Intestinal (CIAP), catalyzes the hydrolysis of 5'-phosphate groups from DNA, RNA, and ribo- and deoxyribonucleoside triphosphates. This enzyme is used to prevent recircularization and religation of linearized cloning vector DNA by removing phosphate groups from both 5'-termini and may also be used for the dephosphorylation of 5' phosphorylated ends of DNA or RNA for subsequent labeling with [32P]ATP and T4 Polynucleotide Kinase. CIAP is active on 5' overhangs, 5' recessed and blunt ends.

Visit Product Page »
DNA Polymerase I Open/Close Open/Close Add
Can be used in a variety of molecular applications
Is inactivated by heating at 68°C for 10 minutes
Supplied at a concentration of 5–10u/μl

DNA Polymerase I catalyzes the template-directed polymerization of nucleotides into duplex DNA in a 5'-->3' direction. DNA Polymerase I possesses a 3'-->5' exonuclease activity or proofreading function, which lowers the error rate during DNA replication, and also contains a 5'-->3' exonuclease activity, which enables the enzyme to replace nucleotides in the growing strand of DNA by nick translation. The enzyme, purified from recombinant E. coli, is capable of catalyzing de novo synthesis of synthetic homopolymers and provides a convenient method for the preparation of a variety of defined DNA substrates.

Visit Product Page »
DNA Polymerase I Large (Klenow) Fragment Open/Close Open/Close Add
Use in a variety of molecular applications
Heat-inactivate by heating at 75°C for 10 minutes
Active in many Promega 1X restriction enzyme buffers
Supplied at a concentration of 5u/μl
Intended for Laboratory Use (GPR) in the United States. Outside of the United States, this product is intended for research use only unless otherwise stated

DNA Polymerase I Large (Klenow) Fragment is a DNA-dependent DNA polymerase that lacks the 5'-->3' exonuclease activity of intact E. coli DNA Polymerase I but retains its 5'-->3' polymerase, 3'-->5' exonuclease and strand displacement activities. The enzyme is a 68kDa C-terminal fragment of DNA Polymerase I. The 5'-->3' polymerase activity of Klenow Fragment can be used to fill in 5'-protruding ends with unlabeled or labeled dNTPs, to sequence single- or double-stranded DNA templates, for in vitro mutagenesis using synthetic oligonucleotides, for cDNA second-strand synthesis and to generate single-stranded DNA probes. The 3'-->5' exonuclease activity can be used to generate blunt ends from a 3'-overhang.

Visit Product Page »
Exonuclease III Open/Close Open/Close Add
Control deletion rate by varying incubation temperature
Inactivate Exonuclease III by heating at 75°C for 10 minutes
Supplied at a concentration of 150–200u/μl

Exonuclease III is a 3'-->5' exonuclease specific for double-stranded DNA. The enzyme catalyzes the stepwise removal of mononucleotides starting from a 3'-OH at nicks, blunt ends, recessed ends and 3'-overhangs of less than 4 bases, yielding nucleoside 5'-phosphates. Exonuclease III will also degrade DNA from 3'-phosphate ends due to its intrinsic 3'-phosphatase activity. In addition, the enzyme has apurinic endonuclease activity and ribonuclease H activity. Exonuclease III is used in conjunction with S1 nuclease for unidirectional deletion of sequences from the termini of DNA fragments.

Visit Product Page »
Flexi Cloning System Open/Close Open/Close Add
Choose from a variety of initial applications (e.g., bacterial protein, mammalian or cell-free protein expression) and then transfer the insert as required
Efficient insert transfer means direct use of recombinant clones with minimal time for screening background colonies
Adaptable to high-throughput formats for large screening projects

A directional cloning method for protein-coding sequences, Flexi Vector System is based on 2 rare-cutting restriction enzymes, SgfI & PmeI, and provides a rapid, efficient and high-fidelity way to transfer protein-coding regions without resequencing. Flexi Vectors carry the lethal barnase gene, replaced by the DNA fragment of interest to act as a positive selection for successful insert ligation. The system does not require appending multiple amino acids to the amino or carboxy termini of the protein of interest. Nor does it require an archival entry vector; most applications allow direct entry into the vector suited to the experimental design. C-terminal Flexi Vectors allow expression of C-terminal-tagged proteins. While the vectors can act as acceptors of protein-coding regions flanked by SgfI & PmeI, they lack a PmeI site and contain a different blunt-ended site, EcoICRI. This joined sequence cannot be removed from the C-terminal Flexi Vectors and transferred to other Flexi Vectors.

Visit Product Page »
LigaFast Rapid DNA Ligation System Open/Close Open/Close Add
DNA inserts with blunt ends or 5´ or 3´ overhangs can be used for ligation
No purification of ligated DNA needed prior to heat-shock transformation in E. coli
Ligations performed using the LigaFast™ System are comparable to standard overnight ligations

The LigaFast Rapid DNA Ligation System is designed for the efficient ligation of sticky-ended DNA inserts into plasmid vectors in just 5 minutes (blunt-ended inserts in as little as 15 minutes). Rapid ligation is based on the combination of T4 DNA Ligase with a unique 2X Rapid Ligation Buffer. The LigaFast System is designed to eliminate any further purification prior to transformation of ligated DNA. The specially formulated 2X Rapid Ligation Buffer requires no additional ATP or Mg(2+) addition prior to use.

Visit Product Page »
pUC/M13 Sequencing Primers Open/Close Open/Close Add
Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
Supplied at a concentration of 10μg/ml
pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.

Visit Product Page »
Ribonuclease H Open/Close Open/Close Add
Removes the RNA strand prior to second-strand cDNA synthesis
Analyzes in vitro polyadenylation reaction products
Supplied at a concentration of 0.5–2u/μl
Intended for Laboratory Use (GPR) in the United States. Outside of the United States, this product is intended for research use only unless otherwise stated

Ribonuclease H (RNase H) is an endonuclease that specifically hydrolyzes the phosphodiester bonds of RNA hybridized to DNA to produce 3'-OH and 5'-P-terminated products. It will not degrade single-stranded nucleic acids, double-stranded DNA or double-stranded RNA.

Visit Product Page »
RNase ONE Ribonuclease Open/Close Open/Close Add
Ability to cleave a phosphodiester bond between any two ribonucleotides
Supplied at a concentration of 5–10u/μl
Intended for Laboratory Use (GPR) in the United States. Outside of the United States, this product is intended for research use only unless otherwise stated

RNase ONE Ribonuclease is a 27kDa periplasmic enzyme from E. coli that catalyzes the degradation of RNA to cyclic nucleotide monophosphate (NMP) intermediates. Slower hydrolysis further catalyzes the degradation of these intermediates to 3'-NMPs. RNase ONE Ribonuclease is one of the few known RNases that can cleave a phosphodiester bond between any two ribonucleotides. RNase ONE Ribonuclease may be used to remove RNA from DNA preparations, for RNase protection assays and for mapping or quantitation of RNA by selective cleavage of single-stranded regions.

Visit Product Page »
RQ1 RNase-Free DNase Open/Close Open/Close Add
Produces 3´ hydroxyl oligonucleotides during degradation
Preparation qualified for use in applications where maintaining the integrity of RNA is critical
Intended for Laboratory Use (GPR) in the United States. Outside of the United States, this product is intended for research use only unless otherwise stated

RQ1 RNase-Free DNase is a preparation of deoxyribonuclease I that degrades single-stranded or double-stranded DNA to produce 3'-hydroxyl oligonucleotides. This preparation is qualified for use in applications where maintaining the integrity of RNA is critical.

Visit Product Page »
S1 Nuclease Open/Close Open/Close Add
Enzyme yields 5´-phosphoryl-terminated products
Double-stranded nucleic acids (DNA:DNA, DNA:RNA or RNA:RNA) resist degradation except with extremely high concentrations of enzyme
Supplied at a concentration of 20–100u/μl

S1 Nuclease degrades single-stranded DNA and RNA endonucleolytically to yield 5'-phosphoryl-terminated products. Double-stranded nucleic acids (DNA:DNA, DNA:RNA or RNA:RNA) are resistant to degradation except with extremely high concentrations of enzyme. The enzyme is used to remove single-stranded termini from double-stranded DNA, for selective cleavage of single-stranded DNA and for mapping RNA transcripts.

Visit Product Page »
Single-Stranded DNA Binding Protein Open/Close Open/Close Add
Consists of four identical 18.9kDa subunits
Does not bind well to double-stranded DNA
Supplied at a concentration of 1–5µg/μl

E. coli Single-Stranded DNA Binding Protein (SSB) consists of four identical 18.9kDa subunits. It binds with high affinity in a cooperative manner to single-stranded DNA but does not bind well to double-stranded DNA. It is involved in DNA replication and in recombination in vivo.

Visit Product Page »
SP6 RNA Polymerase Open/Close Open/Close Add
Exhibits extremely high affinity and specificity for SP6 promoter sequences
>90% pure as determined by SDS polyacrylamide gel electrophoresis
Free of detectable levels of contaminating RNase and DNase activity (<1% release)

SP6 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only SP6 DNA or DNA cloned downstream from an SP6 promoter can serve as a template for SP6 RNA Polymerase-directed RNA synthesis.

Visit Product Page »
SP6 RNA Polymerase Promoter Sequencing Primer Open/Close Open/Close Add
Designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA
Purified by gel electrophoresis or HPLC
Primer Sequence: 5´-d(TATTTAGGTGACACTATAG)-3´
Supplied at a concentration of 10µg/ml

The SP6 Promoter Primer is designed for sequencing inserts cloned into the pGEM, pALTER-MAX and pCI-neo Vectors. The primer is designed to be annealed to single-stranded DNA or, after alkaline denaturation, to double-stranded DNA. The promoter primer is purified by gel electrophoresis or HPLC. Primer Sequence: 5'-d(TATTTAGGTGACACTATAG)-3'.

Visit Product Page »
T3 RNA Polymerase Open/Close Open/Close Add
Exhibits extremely high affinity and specificity for T3 promoter sequences
>90% pure as determined by SDS polyacrylamide gel electrophoresis
Free of detectable levels of contaminating RNase and DNase activity (<1% release)
Supplied at a concentration of 10–20u/μl (Cat.# P2083) and 80u/µl (Cat.# P4024)

T3 RNA Polymerase is a DNA-dependent RNA polymerase that exhibits extremely high specificity for its cognate promoter sequences. Only T3 DNA or DNA cloned downstream from a T3 promoter can serve as a template for T3 RNA Polymerase-directed RNA synthesis.

Visit Product Page »
T4 DNA Ligase Open/Close Open/Close Add
Use with 5´, 3´ or blunt-ended dsDNA (e.g., inserts and vectors)
Qualified for blue/white cloning, providing a higher level of quality control for enzymes used in cloning applications
Can catalyze the joining of RNA to either a DNA or RNA strand in a duplex molecule
Intended for Laboratory Use (GPR) in the United States. Outside of the United States, this product is intended for research use only unless otherwise stated

T4 DNA Ligase catalyzes the joining of two strands of DNA between the 5'-phosphate and the 3'-hydroxyl groups of adjacent nucleotides in either a cohesive-ended or blunt-ended configuration. The enzyme has also been shown to catalyze the joining of RNA to either a DNA or RNA strand in a duplex molecule but will not join single-stranded nucleic acids.

Visit Product Page »
T4 DNA Polymerase Open/Close Open/Close Add
High fidelity enzyme of choice for applications where misincorporation is a concern
Flexible polymerase used in a variety of molecular applications; active in many Promega 1X restriction enzyme buffers
Heat inactivated by heating at 75°C for 10 minutes
Supplied at a concentration of 5–10u/μl

T4 DNA Polymerase catalyzes the 5'-->3' synthesis of DNA from a primed single-stranded DNA template. Although possessing a potent 3'-->5' proofreading exonuclease, T4 DNA Polymerase contains no 5'-->3' exonuclease activity. T4 DNA Polymerase can be used to fill 5' protruding ends with labeled or unlabeled dNTPs or for the generation of blunt ends from DNA molecules with 3' overhangs.

Visit Product Page »
T4 Polynucleotide Kinase Open/Close Open/Close Add
Can be inactivated by heating at 68°C for 10 minutes
Blue/white cloning qualified, providing a higher level of quality control for enzymes used in cloning applications
Labels the 5´ end of ssDNA, dsDNA and RNA molecules for use as probes or for sequencing or DNA-protein footprinting
Supplied at a concentration of 5–10u/μl

T4 Polynucleotide Kinase catalyzes the transfer of the gamma-phosphate from ATP to the 5'-terminus of polynucleotides or to mononucleotides bearing a 5'-hydroxyl group. The enzyme, purified from recombinant E. coli, may be used to phosphorylate RNA, DNA and synthetic oligonucleotides prior to subsequent manipulations such as ligation.

Visit Product Page »
T4 RNA Ligase Open/Close Open/Close Add
Adds [5´-32P] nucleoside 3´,5´-bis (phosphate) onto single-stranded RNA
Can be inactivated by heating at 65°C for 15 minutes
Supplied at a concentration of 10u/μl

T4 RNA Ligase catalyzes the ATP-dependent ligation of single-stranded RNA or DNA onto the 5'-phosphoryl termini of single-stranded RNA or DNA. The enzyme, purified from recombinant E. coli CA4 (RNase I-deficient), has an apparent molecular weight of 43.5kDa. T4 RNA Ligase also catalyzes the addition of [5'-32P] nucleoside 3',5'-bis (phosphate) onto single-stranded RNA.

Visit Product Page »
Terminal Deoxynucleotidyl Transferase, Recombinant Open/Close Open/Close Add
Adds mononucleotide tails to any type of 3´ end (3´ and 5´ overhangs or blunt ends) due to the presence of 1mM CoCl2 in the reaction buffer
Quality tested for labeling of apoptotic DNA ends using the procedure outlined in the DeadEnd™ Fluorometric TUNEL System Technical Bulletin #TB235 for each lot of enzyme
Supplied at a concentration of 30u/μl

Terminal Deoxynucleotidyl Transferase, Recombinant, catalyzes the repetitive addition of mononucleotides to the terminal 3'-OH of a DNA initiator accompanied by the release of inorganic phosphate. Single-stranded DNA is preferred as an initiator. Polymerization is not template-dependent. The addition of 1mM Co(2+) (as CoCl(2)) in the reaction buffer allows the tailing of 3'-ends with varying degrees of efficiency.

Visit Product Page »