Promega's Política de cookies

Empleamos cookies y tecnologías similares para mantener la funcionalidad de nuestro sitio web, analizar su rendimiento, mejorar el funcionamiento y mostrar contenido personalizado. Algunas cookies son esenciales para el buen funcionamiento de nuestro sitio web. El resto no serán instaladas en su equipo sin su consentimiento. Visite la Política de Cookies para obtener mayor detalle.

CloneWeaver® Workflow Purchasing Tool

Previous Next

Vectors: Subcloning Change

Name Description Part Number
pSP73 Vector Open/Close Add
Versatile vector that can be used for standard cloning and in vitro transcription
SP6 and T7 RNA polymerase promoters flank the multiple cloning region
Multiple cloning site provides a convenient selection of restriction sites for cloning

The pSP73 Vector can be used as a standard cloning vector and also can be used for transcription of RNA in vitro The pSP73 Vector contains the SP6 and T7 RNA polymerase promoters and a unique multiple cloning region, which includes restriction sites for BglII, EcoRV, ClaI, EcoRI, SacI, KpnI, SmaI, BamHI, XbaI, SalI, AccI, PstI, SphI, HindIII, PvuII and XhoI. The pSP72 and pSP73 Vectors are essentially identical except for the orientation of the multiple cloning site region.

Visit Product Page »
pUC/M13 Sequencing Primers Open/Close Add
Sequence other lacZ-containing plasmids such as the pGEM®-Z and pGEM®-Zf Vectors
Supplied at a concentration of 10μg/ml
pUC/M13 Primer, Forward (17mer; Cat.# Q5391), is no longer available
pUC/M13 Primer, Reverse (22mer; Cat.# Q5421), is no longer available

The pUC/M13 Primers are designed for sequencing inserts cloned into the M13 vectors and pUC plasmids. These primers also can be used for sequencing other lacZ-containing plasmids such as the pGEM-Z and pGEM-Zf Vectors. The primers are purified by gel electrophoresis or HPLC. Primer Sequences: [Reverse (17mer)] 5'-d(CAGGAAACAGCTATGAC)-3', [Forward (24mer)] 5'-d(CGCCAGGGTTTTCCCAGTCACGAC)-3'.

Visit Product Page »